Worst Fears Realized: Pfizer mRNA Integrates into your DNA
mRNA Vaccines Actually are "Gene Therapy", Study Shows
by Igor Chudov
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
For over a year, our trusted “heath experts and fact checkers” kept telling us the opposite:
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.
Details
✓
What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the reverse: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nuclear and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.
After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.
The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTAAnyone wants to run BLAST on it?
✓
Cancer Code
Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big implication for our public health.
Yes, I started going on about reverse transcriptase permanently changing the species genome about two years ago as a NYT commenter with 35 "Times Picks" accumulated until they banned me for life. Pretty much everything I wrote (a lot!) - the opposite of what they reported - has all turned out to be true. (The NYT lies to your face constantly, from Vietnam to WMDs to Covid, and likely about Ukraine) Let's remember the mainstream media does not "inform you" as they like to say, instead their job is to program you. Everyone made fun of the possibility of DNA change; guess no one knew that reverse transcriptase had been around since the 1970's and the biological possibility is real. This study needs replication and further research with the other so-called vaccines. If true, it means this vaccination "mistake" is non-reversible, except by forced sterilization or genocide of those who were vaxxed.
The problem is that people think of these genetic manipulations as vaccinations regardless of the fact that they meet neither the medical nor legal definitions of a vaccine. The manufacturers originally called them genetic therapies in their trials but WHO changed the definition of "vaccine" so they'd get under the vaccine liability umbrella - and also so people would think they were as safe as "vaccines," some of which are safe, at least the Live vaccines.
The Dead vaccines, which all require boosters - the subunit, inactivated, and toxoid vaccines - (DTP, Hep, Tetanus, Pneumonia, new Shingles, new Polio, Flu (via spike)) are Bad, with bad being defined as increasing all-cause mortality regardless of whether they positively affect their primary specific targets.
The Live vaccines (BCG (for TB), MMR, old Polio, old Shingles (Zostavax), Smallpox, Chickenpox, Flu (via nasal spray)) are Good as they have non-specific effects that decrease all-cause mortality. That the Live vaxxes are good is the opposite of what one might think, but is well studied and seems to be correct, although not well publicized or accepted or known by MDs (Malpractice Doctor).
Lol good thing there's an unexpected war going on now to help hide all the bad news.